Hieff NGS™ Full UDI Adapter Kit for Illumina, Set3(Plate-Format) _ 12335ES

YeasenSku: 12335ES01

Size: 96×1 T
Preço:
Preço de venda$505.00

Frete calculado no checkout

Estoque:
Vendido

Descrição

Hieff NGS™ Full UDI Adapter Kit for Illumina is an adapter kit specifically designed for library preparation on Illumina high-throughput sequencing platforms. The kit contains UDI adapters used for next-generation sequencing (NGS) library preparation. Cat#12333–12336 are provided in plate format (Set1/Set2/Set3/Set4). Each set contains 96 adapters, enabling the construction of up to 384 uniquely dual-indexed libraries.

All reagents included in the kit have undergone strict quality control and functional validation to ensure the stability and reproducibility of library preparation to the greatest extent.

Specifications

Cat.No.

12335ES01 / 12335ES02

Size

96×1 T / 96×2 T

Components

Components No.

Name

12335ES01

(96×1 T)

12335ES02

(96×2 T)

12335

UDI Adapter 193-288

5 μL each

10 μL each

Storage

This product should be stored at -25~-15℃ for 2 years.

Notes

1. The concentration of the UDI adapters in this kit is 10 μM. The amount of adapter used for each library preparation should be adjusted according to the requirements of the library preparation kit being used.

2. Do not heat the adapters. Allow them to dissolve slowly at room temperature. The laboratory temperature is recommended to be maintained at 20–25°C. Avoid repeated freeze–thaw cycles. It is recommended to aliquot the adapters for storage, and they may be stored at 4°C for short-term use.

3. The structure of the DNA library constructed using the Hieff NGS™ Full UDI Adapter Kit for Illumina is shown below.

4. For your safety and health, please wear a lab coat and disposable gloves when performing the experiment.

5. This product is for research use only.

Sequence Information

UDI Adapter for Illumina:

i5 Index for Illumina:

5´-AATGATACGGCGACCACCGAGATCTACAC[i5 Index]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´

i7 Index for Illumina:

5´-/5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i7 Index]ATCTCGTATGCCGTCTTCTGCTT*G-3´

The notation [i5 Index] denotes an 8-bp i5 index sequence, and [i7 Index] denotes an 8-bp i7 index sequence.

 

The corresponding positions of each adapter in the 96-well plate are shown in the figure below.

Documents

Safety Data Sheet

12335_MSDS_HB20260316

Manuals

12335_Manual_HB20260421

Pagamento e segurança

American Express Apple Pay Diners Club Discover Google Pay Mastercard Visa

Suas informações de pagamento são processadas com segurança. Não armazenamos detalhes do cartão de crédito nem temos acesso às informações do seu cartão de crédito.

Você também pode gostar

Investigação

Perguntas frequentes

O produto é apenas para fins de pesquisa e não se destina ao uso terapêutico ou diagnóstico em humanos ou animais. Os produtos e o conteúdo são protegidos por patentes, marcas registradas e direitos autorais de propriedade da Yeasen Biotechnology. Os símbolos de marca registrada indicam o país de origem, não necessariamente o registro em todas as regiões.

Certos aplicativos podem exigir direitos adicionais de propriedade intelectual de terceiros.

Yeasen se dedica à ciência ética, acreditando que nossa pesquisa deve abordar questões críticas, garantindo ao mesmo tempo padrões éticos e de segurança.