Hieff NGS™ Full UDI Adapter Kit for Illumina, Set4 (Plate-Format) _ 12336ES

YeasenSku: 12336ES01

Size: 96×1 T
Precio:
Precio de venta$505.00

Envío calculado En caja

Existencias:
Agotado

Descripción

Hieff NGS™ Full UDI Adapter Kit for Illumina is an adapter kit specifically designed for library preparation on Illumina high-throughput sequencing platforms. The kit contains UDI adapters used for next-generation sequencing (NGS) library preparation. Cat#12333–12336 are provided in plate format (Set1/Set2/Set3/Set4). Each set contains 96 adapters, enabling the construction of up to 384 uniquely dual-indexed libraries.

All reagents included in the kit have undergone strict quality control and functional validation to ensure the stability and reproducibility of library preparation to the greatest extent.

Specifications

Cat.No.

12336ES01 / 12336ES02

Size

96×1 T / 96×2 T

Components

Components No.

Name

12336ES01

(96×1 T)

12336ES02

(96×2 T)

12336

UDI Adapter 289-384

5 μL each

10 μL each

Storage

This product should be stored at -25~-15℃ for 2 years.

Notes

1. The concentration of the UDI adapters in this kit is 10 μM. The amount of adapter used for each library preparation should be adjusted according to the requirements of the library preparation kit being used.

2. Do not heat the adapters. Allow them to dissolve slowly at room temperature. The laboratory temperature is recommended to be maintained at 20–25°C. Avoid repeated freeze–thaw cycles. It is recommended to aliquot the adapters for storage, and they may be stored at 4°C for short-term use.

3. The structure of the DNA library constructed using the Hieff NGS™ Full UDI Adapter Kit for Illumina is shown below.

4. For your safety and health, please wear a lab coat and disposable gloves when performing the experiment.

5. This product is for research use only.

Sequence Information

UDI Adapter for Illumina:

i5 Index for Illumina:

5´-AATGATACGGCGACCACCGAGATCTACAC[i5 Index]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´

i7 Index for Illumina:

5´-/5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i7 Index]ATCTCGTATGCCGTCTTCTGCTT*G-3´

The notation [i5 Index] denotes an 8-bp i5 index sequence, and [i7 Index] denotes an 8-bp i7 index sequence.

 

The corresponding positions of each adapter in the 96-well plate are shown in the figure below.

Documents

Safety Data Sheet

12336_MSDS_HB20260316

Manuals

12336_Manual_HB20260421

 

Pago y seguridad

American Express Apple Pay Diners Club Discover Google Pay Mastercard Visa

Su información de pago se procesa de forma segura. No almacenamos detalles de la tarjeta de crédito ni tenemos acceso a la información de su tarjeta de crédito.

También te puede gustar

Consulta

Preguntas frecuentes

El producto es solo para fines de investigación y no está destinado a uso terapéutico o diagnóstico en humanos o animales. Los productos y el contenido están protegidos por patentes, marcas comerciales y derechos de autor propiedad de Yeasen Biotechnology. Los símbolos de marca comercial indican el país de origen, no necesariamente el registro en todas las regiones.

Algunas aplicaciones pueden requerir derechos de propiedad intelectual adicionales de terceros.

Yeasen se dedica a la ciencia ética y cree que nuestra investigación debe abordar cuestiones críticas al tiempo que garantiza la seguridad y los estándares éticos.