Hieff NGS™ Complete Adapter Kit for MGI™, Set 1 (16 barcode) _ 13361ES
Rul over billedet for at zoome ind Klik på billedet for at zoome
Hieff NGS™ Complete Adapter Kit for MGI™, Set 1 (16 barcode) _ 13361ES

Hieff NGS™ Complete Adapter Kit for MGI™, Set 1 (16 barcode) _ 13361ES

YeasenSKU: 13361ES02
Size: 16×2 T
Pris:
$135.00

Fragt beregnet ved kassen

Lager:
På lager

Beskrivelse

This kit is the special kit for high-throughput DNA library preparation for MGI. Set 1 contains 16 kinds of barcode(adapter 57-72); Set 2 contains 96 kinds of barcode. All the reagents provided in the kit are subjected strict quality control and functional verification to ensure the maximum stability and repeatability of the library preparation.

Specifications

Cat.No.

13361ES02 / 13361ES04

13362ES02 / 13362ES04

Size

16×2 T / 16×4 T

96×2 T / 96×4 T

Components

Cat. No.

Name

2 T

4 T

13361

16 barcode

10 μL each

20 μL each

13362

96 barcode

10 μL each

20 μL each

Shipping and Storage

This product should be stored at -25~-15℃ for 2 years.

Note

1. The concentration of DNA adapters in these kits is 10 μM
2. Do not heat the adapters. They should be dissolved slowly at room temperature. It is best to set the laboratory temperature at 20-25℃. Avoid repeated freezing and thawing of the adapters. It is recommended to store them in separate packs. The adapters can be stored at 4℃ for a short time.
3. There are 96 barcodes at most for MGI adapters. When 96 barcodeproducts are used for library preparation and sequencing, the selection of barcodes shall be operated according to the combination recommended by MGI. See the use method for specific specifications.
4. For your safety and health, please wear experimental clothes and disposable gloves.
5. For research use only.
6. This adapter is not compatible with PCR-free library preparation protocols and must be used with amplification primers (Cat# 12191ES) for library construction.

Instructions

Sequence
The structure of libraries prepared with Hieff NGS TM Complete Adapter Kit for MGI are as follows：
5’ - Bottom Adapter - Insert DNA Sequence - Barcode Adapter- 3’
DNA Adapter：
Barcode Adapter：
5’-phos AGTCGGAGGCCAAGCGGTCTTAGGAAGACAAXXXXXXXXXXCAACTCCTTGGCTCACA-3’
Bottom Adapter：5’-TTGTCTTCCTAAGGAACGACATGGCTACGATCCGACTT-3’
Before sequencing, just enter the barcode sequence (10 bp) in the sample sheet.
barcodecombination rules:

Documents:

Safety Data Sheet

13361_MSDS_HB250522_EN.PDF

Manual

13361_Manual_HB20260602

Betaling og sikkerhed

American Express Apple Pay Diners Club Discover Google Pay Mastercard Visa

Dine betalingsoplysninger behandles sikkert. Vi gemmer ikke kreditkortoplysninger og har heller ikke adgang til dine kreditkortoplysninger.

Du kan også lide

Forespørgsel

FAQ

Produktet er kun til forskningsformål og er ikke beregnet til terapeutisk eller diagnostisk brug hos mennesker eller dyr. Produkter og indhold er beskyttet af patenter, varemærker og ophavsrettigheder ejet af Yeasen Biotechnology. Varemærkesymboler angiver oprindelseslandet, ikke nødvendigvis registrering i alle regioner.

Visse applikationer kan kræve yderligere tredjeparts intellektuelle ejendomsrettigheder.

Yeasen er dedikeret til etisk videnskab og mener, at vores forskning bør adressere kritiske spørgsmål og samtidig sikre sikkerhed og etiske standarder.