Hieff NGS™ Full UDI Adapter Kit for Illumina, Set2 (Plate-Format) _ 12334ES

YeasenSKU: 12334ES01

Size: 96×1 T
Giá:
Giá bán$505.00

Vận chuyển được tính toán khi thanh toán

Cổ phần:
Bán hết

Sự miêu tả

Hieff NGS™ Full UDI Adapter Kit for Illumina is an adapter kit specifically designed for library preparation on Illumina high-throughput sequencing platforms. The kit contains UDI adapters used for next-generation sequencing (NGS) library preparation. Cat#12334–12336 are provided in plate format (Set1/Set2/Set3/Set4). Each set contains 96 adapters, enabling the construction of up to 384 uniquely dual-indexed libraries.

All reagents included in the kit have undergone strict quality control and functional validation to ensure the stability and reproducibility of library preparation to the greatest extent.

Specifications

Cat.No.

12334ES01 / 12334ES02

Size

96×1 T / 96×2 T

Components

Components No.

Name

12334ES01

(96×1 T)

12334ES02

(96×2 T)

12334

UDI Adapter 097-192

5 μL each

10 μL each

Storage

This product should be stored at -25~-15℃ for 2 years.

Notes

1. The concentration of the UDI adapters in this kit is 10 μM. The amount of adapter used for each library preparation should be adjusted according to the requirements of the library preparation kit being used.

2. Do not heat the adapters. Allow them to dissolve slowly at room temperature. The laboratory temperature is recommended to be maintained at 20–25°C. Avoid repeated freeze–thaw cycles. It is recommended to aliquot the adapters for storage, and they may be stored at 4°C for short-term use.

3. The structure of the DNA library constructed using the Hieff NGS™ Full UDI Adapter Kit for Illumina is shown below.

4. For your safety and health, please wear a lab coat and disposable gloves when performing the experiment.

5. This product is for research use only.

Sequence Information

UDI Adapter for Illumina:

i5 Index for Illumina:

5´-AATGATACGGCGACCACCGAGATCTACAC[i5 Index]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´

i7 Index for Illumina:

5´-/5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i7 Index]ATCTCGTATGCCGTCTTCTGCTT*G-3´

The notation [i5 Index] denotes an 8-bp i5 index sequence, and [i7 Index] denotes an 8-bp i7 index sequence.

 

The corresponding positions of each adapter in the 96-well plate are shown in the figure below.

Documents

Safety Data Sheet

12334_MSDS_HB20260316

Manuals

12334_Manual_HB20260421

Thanh toán & Bảo mật

American Express Apple Pay Diners Club Discover Google Pay Mastercard Visa

Thông tin thanh toán của bạn được xử lý an toàn. Chúng tôi không lưu trữ chi tiết thẻ tín dụng cũng như không có quyền truy cập vào thông tin thẻ tín dụng của bạn.

Bạn cũng có thể thích

Cuộc điều tra

Câu hỏi thường gặp

Sản phẩm chỉ dành cho mục đích nghiên cứu và không dùng để điều trị hoặc chẩn đoán ở người hoặc động vật. Sản phẩm và nội dung được bảo vệ bởi các bằng sáng chế, nhãn hiệu và bản quyền thuộc sở hữu của Yeasen Công nghệ sinh học. Biểu tượng nhãn hiệu chỉ ra quốc gia xuất xứ, không nhất thiết phải đăng ký ở tất cả các khu vực.

Một số ứng dụng có thể yêu cầu thêm quyền sở hữu trí tuệ của bên thứ ba.

Yeasen dành riêng cho khoa học đạo đức, tin rằng nghiên cứu của chúng tôi phải giải quyết các vấn đề quan trọng đồng thời đảm bảo các tiêu chuẩn về an toàn và đạo đức.