Описание
The Replication-competent AAV Serotype 2 (rcAAV2) Detection Kit is designed to quantitatively analyze and detect the potential risk of Replication Competent Adeno-associated Virus (rcAAV) in a variety of gene therapy, oncology and vaccine development products using recombinant adeno-associated viral vectors with AAV2 serotype.
This kit is based on the principle of fluorescent probe quantitative PCR, and uses qPCR to detect rAAV terminal
repeat sequence (ITR) (i.e. Reference gene) and rcAAV linked sequence (i.e. Target gene) respectively, realizing the quantitative detection of rAAV and rcAAV at the same time. The kit also contains DNA quantitative references for the reference gene and the target gene (rcAAV2 Reference&Target DNA Control).
Before using this kit, make sure that the sample to be tested also meets the following conditions:
1. The serotype of the adeno-associated virus in the sample to be tested is AAV2;
2. The ITR sequence of the recombinant adeno-associated viral vector rAAV in the sample to be tested needs to be matched with the ITR sequence of rAAV2 as described below:
>rAAV-2/N ITR sequence:
TTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT
Features
- Compliance with regulations: the products are fully validated according to the requirements of Chp, USP, ICH, etc., and their performance is in line with Chinese and foreign regulations and standards;
- Guarantee of quality: the raw materials of the kits are all self-developed, and the qPCR Mix and other enzyme products are produced in an ultra-clean enzyme factory;
- High sensitivity: the lower limit of quantification (LLOQ) was 2 copies/uL;
- High precision: high intra-batch reproducibility CV <10%, small inter-batch variation i.e. intermediate precision CV <15%;
- Strong specificity: specific detection of rcAAV2 residual DNA without interference from other exogenous genomic DNA;
- Strong anti-interference: the introduction of internal quality control (Reference) can exclude sample interference, abnormal reaction preparation and other factors, effectively avoiding false negatives.
Application
- Residual rcAAV2 DNA test in biological products.
Specifications
Sensitivity |
2 copies/uL (rang: Referenceand Target are all 2×101~2×106copies/μL) |
Assay Time |
~1.5 hours |
Assay Principle |
Fluorescent probe qPCR method |
Required Instruments |
Real-time fluorescence quantitative PCR system |
Product Performance
Product Performance Validation Program |
Reference standards or requirements |
YEASEN |
|
1. Standards for the kit |
Homemade standards are available |
Plasmid DNA containing Reference gene and Target gene |
|
2. Linear Range |
Assay Range |
Refer to the actual situation |
2x101~2x106 copies/μL |
R2 |
≥0.98 |
≥0.99 and above |
|
Slope |
-3.1~-3.8 |
-3.1~-3.6 |
|
Amplification Efficiency |
84%~109% |
90%~109% |
|
3. Accuracy |
Recovery Rate |
50%~150% |
70%~130% and above |
4. Precision |
Repeatability |
CV≤15% |
<10% |
Intermediate precision |
CV≤15% |
<15% |
|
5. Exclusivity |
No interference with DNA from other sources |
Specific detection of rcAAV2 DNA without interference from other exogenous DNA |
|
6. Sensitivity |
Limit of quantification |
Reliable quantification of the smallest concentrations of target substances |
2 copies/μL |
Limit of detection |
Refer to the actual situation |
0.125 copies/μL |
|
7. Durability |
Reagent Stability |
Evaluating the effect of different storage temperatures on reagent performance |
2~8°C for 30 days and 37°C for 14 days, and repeated freeze-thaw 10 times, the kit amplification efficiency is in the range of 90%~109%, R2≥0.99 and above |
Instrument Compatibility |
Kits are used on different devices without affecting the test results |
Compatible with many types of qPCR Instruments (eg. Bio-Rad CFX96 Optic Module, Thermo Scientific ABI 7500, ABI Quant Studio 5) |
Components
Components No. |
Name |
41327ES50 |
41327ES60 |
41327-A |
rcAAV2 qPCR Mix |
300 μL×2 |
600 μL×2 |
41327-B1 |
rcAAV2 Reference Primer&probe Mix |
200 μL |
400 μL |
41327-B2 |
rcAAV2 Target Primer&probe Mix |
200 μL |
400 μL |
41327-C |
DNA Dilution Buffer |
1.8 mL×2 |
1.8 mL×4 |
41327-D |
rcAAV2 Reference&Target DNA Control (2×108 copies/μL) |
50 μL |
100 μL |
Storage
This product should be stored at -25~-15℃ for 2 years.
Both 41327-A, 41327-B1 and 41327-B2 should be stored protected from light.
Figures
- Limit of quantification
rcAAV2 DNA at concentrations of 2×101 copies/uL, 10 copies/uL, 5 copies/μL, 2 copies/μL and 1 copies/uL (with Target DNA and Reference DNA) were detected, with 10 replicates for each concentration, respectively. The results showed that the CV of rcAAV2 DNA was <20% at concentrations of 2copies/μL and above. Therefore, the limit of quantification in the rcAAV2 DNA residue detection kits was 2copies/μL.
Table 1. Limit of quantification (LOQ) assay results for rcAAV2 DNA
Repetition number
Test item |
Target (copies/μL) |
Reference (copies/μL) |
||
Quantity |
Return ratio |
Quantity |
Return ratio |
|
1 |
2.34 |
117.01 % |
1.97 |
98.63 % |
2 |
2.13 |
106.26 % |
1.92 |
96.22 % |
3 |
2.06 |
103.24 % |
2.45 |
122.39 % |
4 |
1.99 |
99.43 % |
2.15 |
107.52 % |
5 |
1.93 |
96.26 % |
1.78 |
89.14 % |
6 |
1.93 |
96.56% |
2.35 |
117.72 % |
7 |
2.27 |
113.69% |
1.80 |
90.16 % |
8 |
2.38 |
119.10% |
1.65 |
82.39 % |
9 |
2.41 |
120.73% |
1.88 |
94.25 % |
10 |
1.85 |
92.43 % |
1.83 |
91.40 % |
Average value |
2.13 |
\ |
1.98 |
\ |
CV |
9.83% |
\ |
13.87% |
\ |

Figure 1. 2 copies/μL rcAAV2 DNA qPCR assay results
- Limit of detection
The detection of Target and Reference at various concentration points under the quantitative limit, combined with the blank limit requirements, yields the detection limit of the reagent kit. The results show that at concentrations of 0.125 copies/μL and above, in 20 repeated wells, ≥19 wells are detected (i.e., the detection rate is ≥95%). Therefore, the detection limit of the replicative adeno-associated virus serotype 2 (rcAAV2) detection reagent kit can reach 0.125 copies/μL.
Table 2. Limit of detection (LOD) assay results for rcAAV2 DNA
Ct value Theoretical concentration |
Target (copies/μL) |
Reference (copies/μL) |
||||
0.25 |
0.125 |
0.0625 |
0.25 |
0.125 |
0.0625 |
|
Positive count / Total count |
20/20 |
19/20 |
18/20 |
20/20 |
19/20 |
19/20 |
Detection rate |
100% |
95% |
90% |
100% |
95% |
95% |
Documents:
Safety Data Sheet
Manuals
Оплата и безопасность
Ваша платежная информация обрабатывается надежно. Мы не храним данные кредитной карты и не имеем доступа к информации вашей кредитной карты.
Расследование
Вам также может понравиться
Часто задаваемые вопросы
Продукт предназначен только для исследовательских целей и не предназначен для терапевтического или диагностического использования на людях или животных. Продукты и содержимое защищены патентами, товарными знаками и авторскими правами, принадлежащими Yeasen Biotechnology. Символы товарных знаков указывают на страну происхождения, а не обязательно на регистрацию во всех регионах.
Для некоторых приложений могут потребоваться дополнительные права интеллектуальной собственности третьих лиц.
Йесен привержен этической науке, полагая, что наши исследования должны затрагивать важнейшие вопросы, обеспечивая при этом безопасность и соблюдение этических стандартов.