Hieff NGS™ Complete Adapter Kit for MGI™, Set 1 (16 barcode) _ 13361ES
Перевернуть изображение, чтобы увеличить Нажмите на изображение, чтобы увеличить
Hieff NGS™ Complete Adapter Kit for MGI™, Set 1 (16 barcode) _ 13361ES

Hieff NGS™ Complete Adapter Kit for MGI™, Set 1 (16 barcode) _ 13361ES

YeasenSku: 13361ES02
Size: 16×2 T
Цена:
$135.00

Доставка рассчитана на кассе

Запас:
В наличии

Описание

This kit is the special kit for high-throughput DNA library preparation for MGI. Set 1 contains 16 kinds of barcode(adapter 57-72); Set 2 contains 96 kinds of barcode. All the reagents provided in the kit are subjected strict quality control and functional verification to ensure the maximum stability and repeatability of the library preparation.

Specifications

Cat.No.

13361ES02 / 13361ES04

13362ES02 / 13362ES04

Size

16×2 T / 16×4 T

96×2 T / 96×4 T

Components

Cat. No.

Name

2 T

4 T

13361

16 barcode

10 μL each

20 μL each

13362

96 barcode

10 μL each

20 μL each

Shipping and Storage

This product should be stored at -25~-15℃ for 2 years.

Note

1. The concentration of DNA adapters in these kits is 10 μM
2. Do not heat the adapters. They should be dissolved slowly at room temperature. It is best to set the laboratory temperature at 20-25℃. Avoid repeated freezing and thawing of the adapters. It is recommended to store them in separate packs. The adapters can be stored at 4℃ for a short time.
3. There are 96 barcodes at most for MGI adapters. When 96 barcodeproducts are used for library preparation and sequencing, the selection of barcodes shall be operated according to the combination recommended by MGI. See the use method for specific specifications.
4. For your safety and health, please wear experimental clothes and disposable gloves.
5. For research use only.
6. This adapter is not compatible with PCR-free library preparation protocols and must be used with amplification primers (Cat# 12191ES) for library construction.

Instructions

Sequence
The structure of libraries prepared with Hieff NGS TM Complete Adapter Kit for MGI are as follows：
5’ - Bottom Adapter - Insert DNA Sequence - Barcode Adapter- 3’
DNA Adapter：
Barcode Adapter：
5’-phos AGTCGGAGGCCAAGCGGTCTTAGGAAGACAAXXXXXXXXXXCAACTCCTTGGCTCACA-3’
Bottom Adapter：5’-TTGTCTTCCTAAGGAACGACATGGCTACGATCCGACTT-3’
Before sequencing, just enter the barcode sequence (10 bp) in the sample sheet.
barcodecombination rules:

Documents:

Safety Data Sheet

13361_MSDS_HB250522_EN.PDF

Manual

13361_Manual_HB20260602

Оплата и безопасность

American Express Apple Pay Diners Club Discover Google Pay Mastercard Visa

Ваша платежная информация обрабатывается надежно. Мы не храним данные кредитной карты и не имеем доступа к информации вашей кредитной карты.

Вам также может понравиться

Расследование

Часто задаваемые вопросы

Продукт предназначен только для исследовательских целей и не предназначен для терапевтического или диагностического использования на людях или животных. Продукты и содержимое защищены патентами, товарными знаками и авторскими правами, принадлежащими Yeasen Biotechnology. Символы товарных знаков указывают на страну происхождения, а не обязательно на регистрацию во всех регионах.

Для некоторых приложений могут потребоваться дополнительные права интеллектуальной собственности третьих лиц.

Йесен привержен этической науке, полагая, что наши исследования должны затрагивать важнейшие вопросы, обеспечивая при этом безопасность и соблюдение этических стандартов.