Hieff NGS™ Complete Adapter Kit for MGI™, Set 1 (16 barcode) _ 13361ES
Rol de afbeelding om in te zoomen Klik op de afbeelding om te zoomen
Hieff NGS™ Complete Adapter Kit for MGI™, Set 1 (16 barcode) _ 13361ES

Hieff NGS™ Complete Adapter Kit for MGI™, Set 1 (16 barcode) _ 13361ES

YeasenSKU: 13361ES02
Size: 16×2 T
Prijs:
$135.00

Verzendkosten berekend bij het afrekenen

Voorraad:
Op voorraad

Beschrijving

This kit is the special kit for high-throughput DNA library preparation for MGI. Set 1 contains 16 kinds of barcode(adapter 57-72); Set 2 contains 96 kinds of barcode. All the reagents provided in the kit are subjected strict quality control and functional verification to ensure the maximum stability and repeatability of the library preparation.

Specifications

Cat.No.

13361ES02 / 13361ES04

13362ES02 / 13362ES04

Size

16×2 T / 16×4 T

96×2 T / 96×4 T

Components

Cat. No.

Name

2 T

4 T

13361

16 barcode

10 μL each

20 μL each

13362

96 barcode

10 μL each

20 μL each

Shipping and Storage

This product should be stored at -25~-15℃ for 2 years.

Note

1. The concentration of DNA adapters in these kits is 10 μM
2. Do not heat the adapters. They should be dissolved slowly at room temperature. It is best to set the laboratory temperature at 20-25℃. Avoid repeated freezing and thawing of the adapters. It is recommended to store them in separate packs. The adapters can be stored at 4℃ for a short time.
3. There are 96 barcodes at most for MGI adapters. When 96 barcodeproducts are used for library preparation and sequencing, the selection of barcodes shall be operated according to the combination recommended by MGI. See the use method for specific specifications.
4. For your safety and health, please wear experimental clothes and disposable gloves.
5. For research use only.
6. This adapter is not compatible with PCR-free library preparation protocols and must be used with amplification primers (Cat# 12191ES) for library construction.

Instructions

Sequence
The structure of libraries prepared with Hieff NGS TM Complete Adapter Kit for MGI are as follows：
5’ - Bottom Adapter - Insert DNA Sequence - Barcode Adapter- 3’
DNA Adapter：
Barcode Adapter：
5’-phos AGTCGGAGGCCAAGCGGTCTTAGGAAGACAAXXXXXXXXXXCAACTCCTTGGCTCACA-3’
Bottom Adapter：5’-TTGTCTTCCTAAGGAACGACATGGCTACGATCCGACTT-3’
Before sequencing, just enter the barcode sequence (10 bp) in the sample sheet.
barcodecombination rules:

Documents:

Safety Data Sheet

13361_MSDS_HB250522_EN.PDF

Manual

13361_Manual_HB20260602

Betaling en beveiliging

American Express Apple Pay Diners Club Discover Google Pay Mastercard Visa

Uw betalingsinformatie wordt veilig verwerkt. We slaan geen creditcardgegevens op en hebben geen toegang tot uw creditcardinformatie.

Misschien vind je het ook leuk

Navraag

FAQ

Het product is alleen bedoeld voor onderzoeksdoeleinden en is niet bedoeld voor therapeutisch of diagnostisch gebruik bij mensen of dieren. Producten en inhoud worden beschermd door patenten, handelsmerken en auteursrechten die eigendom zijn van Yeasen Biotechnologie. Handelsmerksymbolen geven het land van herkomst aan, niet noodzakelijkerwijs registratie in alle regio's.

Voor bepaalde toepassingen zijn mogelijk aanvullende intellectuele eigendomsrechten van derden vereist.

Yeasen is toegewijd aan ethische wetenschap en is van mening dat ons onderzoek kritische vragen moet beantwoorden en tegelijkertijd de veiligheid en ethische normen moet waarborgen.