Hieff NGS™ Unique Dual Barcode Primer Kit for MGI, Set1 (001-096)-13536ES

SKU: 13536ES02

Size: 96 x 2 T
Price:
Sale price$555.00

Shipping calculated at checkout

Stock:
In stock
Bulk Quote Inquiry

Description


Hieff NGS™  Unique Dual Barcode Primer Kit for MGI is a dedicated supporting kit for DNA library construction based on the MGI high-throughput sequencing platform. Using a two-end connector solution, it includes the UDB Adapter and UDB Primer which used in the second-generation sequencing library construction. There are four kinds of sets, and each contains 96 dual-end unique Barcode labeled UDB Primers used in the second generation sequencing library. Together with the MGI library kit provided by YEASEN, it can build up to  384 dual-end unique Barcode labeled libraries. All the reagents provided in the kit were subjected to strict quality control and functional validation, maximizing the stability and repeatability of the library construction.

Specifications

Cat.No.

13536ES02/04

13537ES02/04

13538ES02/04

13539ES02/04

Size

96×2 T/96×4 rxn

96×2 T/96×4 rxn

96×2 T/96×4 rxn

96×2 T/96×4 rxn

Components

Components No.

Name

Component volume

96×2 rxn

96×4 rxn

13536

UDB Adapter

960 μL

2×960 μL

UDB Primer 001-096

10 μL each

20 μL each

13537

UDB Adapter

960 μL

2×960 μL

UDB Primer 097-192

10 μL each

20 μL each

13538

UDB Adapter

960 μL

2×960 μL

UDB Primer 193-288

10 μL each

20 μL each

13539

UDB Adapter

960 μL

2×960 μL

UDB Primer 289-384

10 μL each

20 μL each

Storage

This product should be stored at -25~-15℃ for 18 months.

Notes

1. Please operate with lab coats and disposable gloves,for your safety.

2. The concentration of UDB Adapter in this kit is 10 μM, and the amount of adapter used for the individual library construction is adjusted according to the library construction kit and the starting template input.

3. The UDB Adapter provided by this kit is a universal short adapter, and the complete library should be obtained by PCR amplification. UDB Primer provide Barcode sequence tags to distinguish samples during high-throughput sequencing. The concentration of UDB Primer in this kit is 10 μM.

4. There are four kinds of Sets, each set contains 96 dual-end unique Barcode labeled UDB Primers, and four Sets can build 384 dual-end unique Barcode labeled libraries.

5. Do not heat the adapter, it should slowly dissolve at room temperature, the laboratory temperature is best set at 20-25℃. The adapter should avoid repeated freezing and thawing. It is recommended to be stored separately, and can be briefly stored at 4℃.

6. by using the Hieff NGS®Unique Dual Barcode Primer Kit for MGI®. The sequencing library structure is as follows:

 

 

7. This product is for research use only.

8. Double Barcode sequence designed for MGI platform is based on the principle of base balance. Every 8 as a group for Barcode 1-48 and  Every 4 as a group for Barcode 49-384. In order to achieve the best sequencing quality, when building libraries with different sample numbers, it is recommended to use continuous barcode to construct libraries with more than 8 Barcodes, and then perform machine sequencing after mixing.

Sequence information

UDB Adapter for MGI:

5´-/5Phos/ AGTCGGAGGCCAAGCGGTCTTAGGAAGACAATCAG -3´

5´-TTGTCTTCCTAAGCAACTCCTTGGCTCACAGAACGACATGGCTACGATCCGACTT -3´

Barcode 2 Primer for MGI:

5´-/5Phos/CTCTCAGTACGTCAGCAGTT[Barcode 2]CAACTCCTTGGCTCACAGAAC -3´

Barcode 1 Primer for MGI:

5´-GCATGGCGACCTTATCAG[Barcode 1]TTGTCTTCCTAAGACCGCTTGG-3´

[Barcode 2] represents the 10 bp Barcode 2 sequence and [Barcode 1] represents the 10 bp Barcode 1 sequence.

 

Plate information

 

Note: Dual Barcode sequence design for the MGI platform is based on the principle of base balance. For the Barcode 1-48, every 8 barcodes are one group; For the Barcode 49-384, every 4 barcodes are one group. In order to achieve the best sequencing quality, when building libraries with different sample numbers, it is recommended to use continuous barcode to construct libraries with more than 8 Barcodes, and then perform machine sequencing after mixing.


Manuals

Inquiry

You may also like