설명
Hieff NGS™ Full UDI Adapter Kit for Illumina is an adapter kit specifically designed for library preparation on Illumina high-throughput sequencing platforms. The kit contains UDI adapters used for next-generation sequencing (NGS) library preparation. Cat#12333–12336 are provided in plate format (Set1/Set2/Set3/Set4). Each set contains 96 adapters, enabling the construction of up to 384 uniquely dual-indexed libraries.
All reagents included in the kit have undergone strict quality control and functional validation to ensure the stability and reproducibility of library preparation to the greatest extent.
Specifications
|
Cat.No. |
12335ES01 / 12335ES02 |
|
Size |
96×1 T / 96×2 T |
Components
|
Components No. |
Name |
12335ES01 (96×1 T) |
12335ES02 (96×2 T) |
|
12335 |
UDI Adapter 193-288 |
5 μL each |
10 μL each |
Storage
This product should be stored at -25~-15℃ for 2 years.
Notes
1. The concentration of the UDI adapters in this kit is 10 μM. The amount of adapter used for each library preparation should be adjusted according to the requirements of the library preparation kit being used.
2. Do not heat the adapters. Allow them to dissolve slowly at room temperature. The laboratory temperature is recommended to be maintained at 20–25°C. Avoid repeated freeze–thaw cycles. It is recommended to aliquot the adapters for storage, and they may be stored at 4°C for short-term use.
3. The structure of the DNA library constructed using the Hieff NGS™ Full UDI Adapter Kit for Illumina is shown below.

4. For your safety and health, please wear a lab coat and disposable gloves when performing the experiment.
5. This product is for research use only.
Sequence Information
UDI Adapter for Illumina:
i5 Index for Illumina:
5´-AATGATACGGCGACCACCGAGATCTACAC[i5 Index]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´
i7 Index for Illumina:
5´-/5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i7 Index]ATCTCGTATGCCGTCTTCTGCTT*G-3´
The notation [i5 Index] denotes an 8-bp i5 index sequence, and [i7 Index] denotes an 8-bp i7 index sequence.
The corresponding positions of each adapter in the 96-well plate are shown in the figure below.

Documents
Safety Data Sheet
Manuals
결제 및 보안
귀하의 결제 정보는 안전하게 처리됩니다. 당사는 신용카드 정보를 저장하지 않으며 귀하의 신용카드 정보에 접근할 수 없습니다.
당신은 또한 좋아할 수 있습니다
문의
자주 묻는 질문
이 제품은 연구 목적으로만 사용되며 인간이나 동물의 치료 또는 진단용으로 의도되지 않았습니다. 제품과 콘텐츠는
특정 애플리케이션에는 추가적인 제3자 지적 재산권이 필요할 수 있습니다.
예슨은 윤리적 과학에 헌신하며, 우리의 연구가 안전과 윤리적 기준을 보장하는 동시에 중요한 문제를 해결해야 한다고 믿습니다.

