Hieff NGS™ Stubby UDI Primer Kit for Illumina, PE adapter plus, Set3 ( 193-288) -12329ES

YeasenSKU: 12329ES01

Size: 96x1 T
سعر:
سعر البيع$445.00

الشحن محسوب عند الخروج

مخزون:
نفذ

وصف

Hieff NGS® Stubby UDI Primer Kit for Illumina is a dedicated linker kit for library construction on the Illumina® high-throughput sequencing platform, including PE Adapter and UDI Primer used in next-generation sequencing library construction. The UDI Primer is a master mix of i5 and i7 Primer used with the DNA Library Prep Kit for Illumina®, and 12327-12330 are available in plate packs with 96 indexes each, allowing the construction of up to 384 double-ended unique Index-labeled libraries. All reagents provided in the kit undergo rigorous quality control and functional verification to maximize library construction stability and repeatability.

Components

No.

Name

96×1 T

96×2 T

96×4 T

12327

PE Adapter

336 μL

672 μL

2×672 μL

UDI Primer 001-096

5 μL each

10 μL each

20 μL each

12328

PE Adapter

336 μL

672 μL

2×672 μL

UDI Primer 097-192

5 μL each

10 μL each

20 μL each

12329

PE Adapter

336 μL

672 μL

2×672 μL

UDI Primer 193-288

5 μL each

10 μL each

20 μL each

12330

PE Adapter

336 μL

672 μL

2×672 μL

UDI Primer 289-384

5 μL each

10 μL each

20 μL each

 

Shipping and Storage

All the components are shipped with dry ice and can be stored at -15℃~ -25℃ for 2 years.

Note

 1) The concentration of PE Adapter in this kit is 15 μM, and the amount of linker used for individual library construction is adjusted according to the kit used.

2) The PE Adapter provided with this kit is a general-purpose short adapter that requires PCR amplification to obtain a complete library.

3) UDI Primer provides Index sequence tags at a concentration of 12.5 μM for sample differentiation during high-throughput sequencing.

4) Do not heat the adaptors, let it dissolve slowly at room temperature, and the laboratory temperature is best set to 20-25 °C. It is recommended to store it in aliquots avoiding repeated freeze-thaw and store it at 4°C for a short time.

5) The DNA library structure using the Hieff NGS® Stubby UDI Primer Kit for Illumina® kit is as follows:

6) For your safety and health, please wear a lab coat and wear disposable gloves.

7) This product is for scientific research purposes only!

 

Sequence information

 PE Adapter for Illumina:

5´-/5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGT*C-3´

5´-ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´

i5 Index Primer for Illumina:

5´-AATGATACGGCGACCACCGAGATCTACAC[i5 Index]ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3´

i7 Index Primer for Illumina:

5´-CAAGCAGAAGACGGCATACGAGAT[i7 Index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3´

[i5 Index] 8 bp i5 sequence,[i7 Index]8 bp i7 sequence

The corresponding locations of each primer in 96-well plate are shown:

Payment & Security

American Express Apple Pay Diners Club Discover Google Pay Mastercard Visa

تتم معالجة معلومات الدفع الخاصة بك بشكل آمن. لا نقوم بتخزين تفاصيل بطاقة الائتمان ولا يمكننا الوصول إلى معلومات بطاقة الائتمان الخاصة بك.

You may also like

Inquiry

FAQ

The product is for research purposes only and is not intended for therapeutic or diagnostic use in humans or animals. Products and content are protected by patents, trademarks, and copyrights owned by Yeasen Biotechnology. Trademark symbols indicate the country of origin, not necessarily registration in all regions.

Certain applications may require additional third-party intellectual property rights.

Yeasen is dedicated to ethical science, believing our research should address critical questions while ensuring safety and ethical standards.